faststart universal probe master mix 2x (Merck KGaA)
90
Structured Review
Merck KGaA
faststart universal probe master mix 2x
Faststart Universal Probe Master Mix 2x, supplied by Merck KGaA, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/faststart+universal+probe+master+mix+2x/faststart+universal+probe+master+mix+2x/pmc08027512-113-10-18
Average 90 stars, based on 1 article reviews
Faststart Universal Probe Master Mix 2x, supplied by Merck KGaA, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/faststart+universal+probe+master+mix+2x/faststart+universal+probe+master+mix+2x/pmc08027512-113-10-18
Average 90 stars, based on 1 article reviews
faststart universal probe master mix 2x - by Bioz Stars,
2026-09
90/100 stars
Images
Related Articles
Real-time Polymerase Chain Reaction:Article Title: Multidimensional Approach for Investigating the Effects of an Antibiotic–Probiotic Combination on the Equine Hindgut Ecosystem and Microbial Fibrolysis Article Snippet: Oligonucleotide primers CDIFF16S-F (5’TTGAGCGATTTACTTCGGTAAAGA3’) and CDIFF16S-R (5’TGTACTGGCTCACCTTTGATATTCA3’), and CDIFF16S TaqMan probe (FAM-CCACGCGTTACTCACCCGTCCG; MGW, Eurofins Genomics, Germany) specific to C. difficile 16S rRNA gene (NCBI accession number AB548672 ; https://www.ncbi.nlm.nih.gov/nuccore/AB548672 ) were used for the qPCR assay ( ). .. The |